RNA-seq analysis of RASA2 expression in repetitively stimulated T cells showed that although RASA2 levels declined after acute stimulation, they increased upon repeated tumour exposures (Extended Data Fig. 1h. Data are representative of one of three donors. A FACSCanto II (BD) instrument was used to acquire flow cytometry data, which were analyzed using FlowJo v10. ), Nalm6 cell line (originally purchased from ATCC, CRL-3273), LM7 osteosarcoma cells (kindly provided to G.K.s lab by Eugenie Kleinerman of the MD Anderson Cancer Center in 2011), Jurkat reporter cells (gift from Kole Roybal of the University of California, San Francisco), Jurkat cells (originally purchased from ATCC, clone E6-1), HEK293T cells (Lenti- XTM 293T cell line, Takara Bio catalogue no. 10a). l, Normalized values for T cell expansion based on cell counts for T cells with RASA2 transgene versus GFP control (n=3 human T cell donors, mean SEM, shape denotes donor). LT07- 218) at St. Jude. c, Guides targeting RASA2 (pink) across all suppressive conditions. It is important to think about a few things before you begin the application process. Article We made use of our previously described intraperitoneal locoregional osteosarcoma (LM7) model47 and T cells expressing EphA2.CD28z CAR48 (Extended Data Fig. Chen, J.-Y., Lin, J.-R., Cimprich, K. A. The experiment was performed twice with CAR T cells generated from two different healthy donors. Before You Apply. We previously identified RASA2 as a gene target that boosts T cell proliferation and in vitro cancer cell-killing capacity when it is knocked out13. Values represent expression after variance stabilizing transformation (VST). To directly compare the relative T cell expansion and persistence in the same bone marrow niche, we transferred a mix of roughly equal proportions of RASA2-KO and control T cells to Nalm-6 bearing mice and found that RASA2-KO CAR T cells clearly outcompeted control CAR T cells over time in the bone marrow niche (Fig. 5h,i). c, CFSE staining traces showing how suppressive conditions inhibited T cell proliferation compared to vehicle conditions, for one representative human T cell donor. Cancer cell kill after 1, 3, and 6 repeated co-cultures (columns) and for a range of effector T cells to target cancer cell ratios (rows) are displayed over time (each time point in triplicates, lines are mean SD, lines show a fitted curve by a generalized additive model, see methods). After plating, cells were left in the incubator for an hour to ensure adherence to the wells. 2f). 5e,f and Methods). 22, 206 (2021). Science 375, eabj4008 (2022). This Friday, were taking a look at Microsoft and Sonys increasingly bitter feud over Call of Duty and whether U.K. regulators are leaning toward torpedoing the Activision Blizzard deal. On day 0, PBMCs were stimulated on nontissue culturetreated 24-well plates, which were precoated with CD3 and CD28 antibodies (anti-CD3/CD28; CD3: OKT3, CD28: 15E8; Miltenyi Biotec). The enrichment results are now displayed as a summary of enriched terms displayed as bar graphs for all libraries within a category. Line is the mean and shaded area is 95% confidence interval for 3 technical replicates. 1. The efficacy of adoptive T cell therapies for cancer treatment can be limited by suppressive signals from both extrinsic factors and intrinsic inhibitory checkpoints1,2. To test whether RASA2 ablation in TCR T cells could improve control of a liquid tumour bearing the same NY-ESO-1 antigen, we injected Nalm6 leukaemia cells engineered to express NY-ESO-1 on cognate major histocompatibility complex class I molecules (MHCI) into the tail vein of mice (Fig. 10, 702723 (2020). has been a compensated consultant within the last 2 years for Bristol-Myers Squibb, Alexion Pharmaceuticals, Amal Therapeutics, Servier Pharmaceuticals, Neuvogen and Eureka Therapeutics. The 622 GO terms in the mRMR feature list were mapped to the Gene Ontology (GO) terms, the children of the three root GO terms. Shown at the top is the Pearsons correlation coefficient (R) and FDR adjusted p-value (padj) for each scatter plot. Vardhana, S. A. et al. Supervision: J.C., E.S., G.K., J.E., A.A. and A.M. Funding acquisition: J.C., E.S., D.H., J.E., H.O., S.G., G.K., A.A. and A.M. However, the optimal gene targets in human T cells have not been explored systematically. Biol. Cells were sorted for uniformly low CD19 expression. 1g). For the in vivo cell phenotyping and rechallenge experiments, when Preclinical Therapeutics Core staff were not available, J.C. collected the data and was not blinded to the groups. The protein concentrations were determined using Pierce BCA Protein Assay (Thermo Fisher 23227). For the arrayed screen validation experiments, T cells were isolated from two donors and edited with RNPs with gRNAs targeting genes of interest or control guides as indicated above. volume609,pages 174182 (2022)Cite this article. Targeted RASA2 ablation with individual CRISPR guides in two additional donors reproduced the proliferative advantage observed in the screens under all four soluble-factor suppressive conditions (Fig. Data also shown for RASGRP1, a RasGEF with defined roles in TCR signaling and an expression pattern strikingly similar to that of RASA2. The suppressive TME and T cell intrinsic checkpoints can impinge on the efficacy of engineered T cells targeting solid tumours14. 7 Metabolic fitness of RASA2 KO T cells. USA 101, 60626067 (2004). GO TO CLASSROOM MAGAZINES. The data are sent to the PANTHER Classification System which contains up to date GO annotation data for Arabidopsis and other Mice were injected intraperitoneally with 1106 LM7-GFP-ffluc osteosarcoma tumour cells. 10hj). Schmidt, R. et al. c, Shared hits (y-axis) (z-score > 1.5, methods) across the screen conditions (x-axis) including hits unique to each individual screen. The closer the p-value is to zero, the more significant the particular GO term associated with the group of genes is (i.e. The 622 GO terms in the mRMR feature list were mapped to the Gene Ontology (GO) terms, the children of the three root GO terms. Many more tools are available from the software list, such as alternate searching modes, Visualize, non-JavaScript pages. Tissues were paraffin-embedded, sectioned and stained with haematoxylin and eosin. Recombinant human IL-7 and IL-15 (IL-7: 10ngml1; IL-15: 5ngml1; PeproTech) were added to cultures on day 1. For the quality metric of screens by dropout analysis of essential genes, we used essential genes as determined by DepMap19 and GSEA for gene-level log2 fold change. Fast gene set enrichment analysis. Next, a region of interest (ROI) was defined using the rectangle tool to draw a frame around the band of interest. PDE-SAS is proud to showcase the finalists for the 2023 Pennsylvania Teacher of the Year. Article For the functional cancer cell killing assays, the IncuCyte system was used as above. We used a CD28-based CD19 CAR, which has been reported to be a highlysensitive CAR, to test whether loss of RASA2 expression might further boost sensitivity to low-antigen targets with RASA2 ablation33. Finally, as T regulatory cells (Treg cells) are important mediators of T cell dysfunction in multiple tumour types18, we adapted our screening platform to assay cellcell interactions and thereby reveal genes that confer resistance to suppression of effector T cells by Treg cells. 6 Repetitive tumor stimulation assay shows that RASA2 ablation rescues T cells from a dysfunctional state. Within the tumour mass, the immunosuppressive microenvironment poses a substantial barrier to the efficacy of anti-tumour immunity2,11. Gioia, L., Siddique, A., Head, S. R., Salomon, D. R. & Su, A. I. Article. 2f and Extended Data Fig. For experiments with annexin detection, Annexin V Dyes (Essen Bioscience) Red (4641) and Green (4642) were used according to the manufacturers instructions. 4j). A flow-cytometry-based assay confirmed higher mitochondrial mass and activity in both CAR T and TCR T cells lacking RASA2 relative to control cells (Extended Data Fig. Finally, we show that RASA2-ablation in antigen-specific T cells can enhance tumour control and extend survival in multiple preclinical models of liquid and solid tumours. This cancer cell-killing advantage was generally consistent across multiple human blood donors and ratios of effector T cell to cancer cells (Fig. Regulatory T cells exhibit distinct features in human breast cancer. Nat. Feucht, J. et al. Nat. Statistical tests as indicated. a, Metrics of NY-ESO-1-specific 1G4 TCR-T cells after each repetitive co-culture with A375 tumor cells, including percent positive for CD8, NY-ESO-1 1G4 TCR, and activation marker CD25 (assessed by flow cytometry, n=4 T cell donors, lines are mean SEM). f, Cancer cell growth during in vitro cancer cell-killing assay under suppressive conditions. In brief, TCR T cells or CAR T cells were isolated from culture using a CD45 isolation kit (100-0105), plated on pre-coated 96 well plates that were coated with poly-d-lysine (103729-100) at 4105 cells per well in 50l Seahorse XF RPMI supplemented with 10mM glucose, 1mM pyruvate and 2mM glutamine per manufacturers instructions (Seahorse XF RPMI assay medium pack 103681-100). Advanced Statistics. PDE4C and NKX2-6 KOs were found to confer relatively selective resistance in the adenosine condition, and NFKB2 KO was found to increase resistance in the calcineurin inhibitor (tacrolimus and cyclosporine) conditions. 5 Teacher Tips to Create a Culture of Literacy in Your Classroom. ce, Lines show mean; n=2 donors in triplicate; two-sided Wilcoxon test. Tissues were initially reviewed by a blinded member of the UCSFPreclinical Therapeutics Corefor evidence of pathologic abnormalities without knowledge of the experiments from whichthe individual animal tissues were generated. Analysis of gene hits enriched in the highly dividing compared with non-dividing cells that were shared between all screens converged on two candidate resistance target genes: TMEM222 and RASA2 (Fig. This dependence on PI3K signalling suggests that RASA2 may function as an inducible negative regulator of RAS signalling in the setting of cellular activation. j, Mean fluorescence intensity (normalized to control) of inhibitory markers on cells from cohort in i (means.e.m. Fast gene set enrichment analysis. Cell 175, 19581971.e15 (2018). Currently, the NHD Contest Rule Book allow citations in Chicago or MLA Style, but this resource focuses on Chicago Style.. As you complete your research, you should sort your research into primary and secondary sources. Immunity 17, 617627 (2002). Dotted vertical line indicates the second tumor injection. Antibodies used: PE mouse anti-human IFN (BD Biosciences 554701), BV711 mouse anti-human IL-2 (BD Biosciences 563946), Pacific Blue anti-human TNF (Biolegend 502920). Final percentages of AAVS1-KO versus RASA2-KO CAR T cells isolated from the bone marrow at these time points were determined by staining for CAR and EGFR. GO TO CLASSROOM MAGAZINES. Mol. of technical triplicates from one representative donor out of two. Using the set measurements option under the Analyze menu, we set the measurements as mean grey value for the analysis. On Day 14, T cells were stained with CFSE and stimulated with Immunocult in the presence of either tacrolimus (TOCRIS 3631, final concentration 5nM), cyclosporine (TOCRIS 1101, final concentration 50nM), CGS-21680 (TOCRIS 1063, final concentration 20M) or TGF1 (Biolegend 781802, final concentration 10ngml1). GOterm100 KEGG enrichment analysis Grades K - 2. Large-scale CRISPR genetic screens offer a powerful discovery platform to reveal genetic perturbations that render T cells resistant to these inhibitory signals3,8,9,10. 5 Books and Activities About Mindfulness to Incorporate in Your Classrooms Morning Routine. Plitas, G. et al. Immunol. T cells from four distinct human donors are shown across the columns, with Tregs:CD8 ratio shown in the rows. 5 Teacher Tips to Create a Culture of Literacy in Your Classroom. Biological Process GO Terms Cells were transfected with the CAR retroviral plasmid, retroviral packaging plasmids Peg-Pam3-E and a plasmid encoding the RD114 envelope protein using the GeneJuice transfection reagent per manufacturers protocol (Novagen 70967). ; two-sided Wilcoxon test). Horizontal lines are the mean (n=2 human donors, each in triplicates, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, for two-sided unpaired Students t-test, shape denotes donor). News, analysis from the Middle East & worldwide, multimedia & interactives, opinions, documentaries, podcasts, long reads and broadcast schedule. Beijing (AFP) - 11/25/2022 - 09:14 Chinese-Canadian pop star Kris Wu jailed for rape: court document. Curr. Prinzing, B. et al. Lines show the count of A375-RFP+ cancer cells as detected by live-cell microscopy, normalized by their count at t=0. The quantitative PCR was performed with SsoFast EvaGreen Supermix (Bio-Rad 1725201) on a StepOnePlus Real-Time PCR System (Applied Biosystems). PubMed Central Nat. This protocol describes pathway enrichment analysis of gene lists from RNA-seq and other genomics experiments using g:Profiler, GSEA, Cytoscape and EnrichmentMap software. Results representative of 4 human donors. Hundreds of fun educational games and activities for kids to play online. Ideas to Use in the Classroom. g, Flow cytometry data for multiple effector cytokines (labeled on bottom) in NY-ESO-1-specific TCR-T cells (top row) and CD19-specific CAR-T cells (bottom row) after 6 repeated co-cultures with target tumor cells. Cancer Cell 31, 311325 (2017). Writing, review and editing: J.C., E.S., A.A.A., B.P., S.K., K.S., J.E., H.O., S.G., G.K., A.A. and A.M. Genome Biol. 5a). The red pulp of NSG mice contains abundant erythroid precursors (seen here as numerous cells with dense dark nuclei) as well as megakaryocytes. Hyrenius-Wittsten, A. et al. We used four human donors for the stimulation and Treg cell screen, two donors forthe adenosine, cyclosporine and tacrolimus screens,and one donor for the TGF screen. Mitochondrial substrate dependency and maximal respiration levels were determined by assessing OCR. e, Distribution of CFSE staining in RASA2-KO versus control (Ctrl; non-targeting guide RNA) T cells across all suppressive conditions. 9a,b). We also find that RASA2 levels are elevated across multiple models of chronic stimulation. Antigen-presenting T2 cells53 (ATCC CRL-1992) were loaded with the NY-ESO-1157-165 peptide SLLMWITQV (Thermofisher) by incubation at 37C for 1h. Top final dose of peptide was 18M and was subsequently diluted by log5 serial dilutions. Cells were then quenched with warm complete X-vivo medium at a 1:1 volume, spun down, washed twice with warm X-vivo medium, resuspended in 5% FBS/PBS, and then analysed on the Attune flow cytometer. Results of this analysis are provided in Supplementary Table 2. h, Oxygen consumption rate (OCR) trace of TCR T cells after repeated tumour stimulations. GO Term Enrichment for Plants Statistical Over/Under Representation (powered by PANTHER). 5kn). Analysis of our previously published scRNA-seq dataset13 revealed that RASA2 is downregulated following stimulation in human T cells (Extended Data Fig. Carnevale, J., Shifrut, E., Kale, N. et al. Next, the cells were permeabilized by adding BD Phosflow Perm Buffer III and incubated30 minutes to overnight at 20C. Publishers note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. The Teacher of the Year program recognizes excellence in teaching by honoring K-12 teachers in public education who have made outstanding academic contributions to Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. Google Scholar. RNA-seq analysis showed that RASA2-KO T cells expressed higher levels of genes associated with the cell cycle (VRK1, AURKA and KNL1), fatty acid metabolism (SLC27A2) and mitochondria compared with control-edited T cells after repeated stimulations (Extended Data Fig. Nuclear power is the use of nuclear reactions to produce electricity.Nuclear power can be obtained from nuclear fission, nuclear decay and nuclear fusion reactions. 7f). Cell 45, 196209 (2012). 1h). The AAVs were further purified using iodixanol gradient ultracentrifugation. This acute endogenous reduction of RASA2 after stimulation may give T cells a window of heightened effector function, and genetic ablation of RASA2 may amplify this phenomenon through complete and enduring loss of RASA2. Ablation of RASA2 in multiple preclinical models of T cell receptor and CAR T cell therapies prolonged survival in mice xenografted with either liquid or solid tumours. 4c). 6a,b). f,g, Effector cytokine production after repeated stimulations, as measured by flow cytometry (f; n=2 donors in triplicate; shape denotes donor) or by multiplex ELISA (g; n=3 donors; technical duplicates as dots; lines show mean; two-sided Wilcoxon test). Eur. Provided by the Springer Nature SharedIt content-sharing initiative. Since its founding in 1936, JM has played a significant role in shaping the content and boundaries of The next day, CAR transduction was performed using electroporated cells. Nat. h. Summary data for CAR expression in gene targeted T-cells as measured by flow cytometry (n=10 for CTRL, n=14 for RASA2). T cells were subjected to the repeated stimulation assay in 24-well plates, transferring T cells to freshly seeded cancer cells every 48h. Cultured T cells were sorted after each stimulation using BD FACSAria Fusion to obtain a pure population of NY-ESO-1 multimer positive cells T cells from the co-cultures with target cancer cells, and resuspended in TRI Reagent (Sigma T9424). DepMap 22Q1 Public. Only data from cells labelled as CD8 T cells from the peripheral and tumor samples were used for analysis. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPRCas9. No cancer cell killing is observed with either RASA2 KO or CTRL T cells in the antigen-negative condition. Modular design of synthetic receptors for programmed gene regulation in cell therapies. g, Scheme of EphA2-specific CAR retroviral vectors. 1b, Extended Data Fig. e, Representative data from one CAR-T cell donor for cancer killing assays with target Nalm6 leukemia cells (each time point in triplicates, lines are mean SD). HLA-A2.1-associated peptides from a mutant cell line: a second pathway of antigen presentation. For complete definitions of PubMed Su, A. I. et al. One reaction of RNP was generated by incubating 60pmol of Cas9 protein with 120pmol sgRNA (Synthego, TRAC guide RNA (gRNA): ACAGGGUUCUGGAUAUCUGU) at 37C. Mice were followed over time with bioluminescence imaging and monitored by weight and for any signs of morbidity per our UCSF IACUC protocol. The Chicago Manual of Style is the style most commonly used by professional historians when they write and publish their work. Right, CAR T cell killing of Nalm6 cells expressing varying CD19 levels, measured by annexin staining. and G.K. Nature 545, 452456 (2017). 1e and Supplementary Table 3). CRISPR-engineered T cells in patients with refractory cancer. Here we extended this strategy to model multiple challenges to T cell function in the TME. Although this stimulation-dependence mitigates some concerns of using RASA2-deficient T cells therapeutically, these cells could also be engineered with suicide switches and synthetic circuits for tighter control over the T cell products50. Paste or type the names of the genes to be analyzed, one per row or separated by a comma. Fast gene set enrichment analysis. Targeted gene editing has the potential to overcome these limitations and enhance T cell therapeutic function3,4,5,6,7,8,9,10. https://doi.org/10.1038/s41586-022-05126-w. Get the most important science stories of the day, free in your inbox. Regateiro, F. S. et al. One 20l electroporation reaction was transferred to one well of a 48-well tissue culture treated plate containing RPMI 1640 supplemented with 20%FBS, 1% Glutamax, 10ngml1 IL-7, and 5ngml1 IL-15 (recovery medium) for overnight. For human TIL data (Fig. Targeting REGNASE-1 programs long-lived effector T cells for cancer therapy. Eight- to twelve-week-old NOD/SCID/IL-2R-null (NSG) male mice were obtained through Jax Labs or in-house breeding. Stimulated CD8 T cells were stained by CFSE to track their proliferation in co-culture with suppressive Tregs. Recombinant AAV6 donor vector was added to the culture 30 to 60min after electroporation, at the indicated multiplicity of infection (105), and incubated with the cells overnight. 3m). In contrast to control-edited T cells that showed a gradual decline in the ability to control the growth of cancer cells with each stimulation, RASA2-ablated T cells maintained their robust killing capacity after multiple stimulations (Extended Data Fig. These CAR T cells were co-cultured with cancer cells engineered to express a range of CD19 levels and cancer cell killing was assayed by annexin staining. Find latest news from every corner of the globe at Reuters.com, your online source for breaking international news coverage. Fifteen micrograms of protein per sample was loaded onto 415% tris-glycine SDS gels (Bio-Rad) followed by transfer to PVDF membrane (Bio-Rad) using the Biorad Trans-Blot Transfer system. Sci Rep. 7, 737 (2017). 20, 5570 (2020). Use of genome-targeted CAR integration with CRISPR may help to reduce the risk of insertional mutagenesis in additional genes that could serve as tumour suppressors, which is possible with lentiviral or retroviral CAR transduction. Tumour cells were seeded in complete RPMI medium one day prior to co-culture. These limits were not exceeded in any of the experiments. Cancer Discov. a, Experimental timeline. Transl. For validation of the Treg cell resistance, Treg cells were isolated as above and mixed with donor-matched CFSE-stained effector T cells at varying cell to cell ratios. For Mitotracker probe staining, T cells were incubated in a 96 well plate at 200,000 cells per well in 25nM mitotracker Green FM (M7514) or Mitotracker Red CMXRos (M7512) in 100l of warm X-Vivo medium in the incubator for 30min. Cell 168, 724740 (2017). Mouse tissues (spleen, bone marrow and lymph nodes) were fixed in phosphate buffered formalin. b, Densitometry measurements calculated for p-MEK and p-ERK westerns and averaged for all 3 T cell donors (mean SEM, *p<0.05 and **p<0.01 for two-sided paired t-test) c, Western blots showing the effect of RASA2 ablation compared to control-edited T cells for phospho-MEK and phospho-ERK over time after TCR stimulation in primary human T cells from 3 human donors from (b). 4b). Press the Escape key to close. ), in vitro activated human T cells20 (m; n=91 donors; two-sided Wilcoxon test), a mouse model of tumour-infiltrating T cells38 (TIL) (n, showing days after T cell transfer; n=3 mice; means.e.m.) Antigen-specific T cells were co-cultured with pre-plated RFP+ A375 or GFP+ Nalm6 tumour cells in a 96-well flat bottom plate starting at a 2:1 E:T ratio then with a log2 serial dilution in triplicates. Ther. You will want to gather information regarding your employment history, dates, addresses and phone numbers for previous employers and references; anything you may not know off the top of your head. Med. ), Nalm6 cells expressing NY-ESO-1 (generated by J.E. All Seahorse assays were run on a Seahorse XFe96 Analyzer. Twenty microlitres of cells+RNP were electroporated using program EH-115. Cells were kept in culture at a 106 cells per ml density throughout, and cultured with IL-2 at 50IUml1 (unless otherwise specified). F.B. Asto our knowledgeRASA2 has no previously described roles in T cell biology, we next evaluated its endogenous transcriptional regulation in T cells. 9 RASA2 ablation in TCR-T and CAR-T cells improves tumor control. l, Summary statistics for area under the growth curve of cancer cells over a range of effector T cell:target cell ratios (n=7 donors; means.e.m. We validated other gene targets as conferring resistance across suppressive conditions, such as PFN1, FAM49B (also known as CYRIB), CBLB and RASA2. Cell 184, 35733587.e29 (2021). Click the Soil Map tab to view or print a soil map, and detailed descriptions of the soils in your Area of Interest.. Click or Press the Enter or Spacebar key to view the larger image. Seahorse real-time cell metabolic analysis showed that RASA2 ablation led to increased basal and maximal oxygen consumption rates and extracellular acidification rates compared with control-edited T cells after repeated stimulation (Fig. Notably, this heightened signalling response to antigen did not drive these cells towards dysfunction. As expected, tumor naive NSG mice had few cells of lymphoid appearance in their white pulp (seen here as few mononuclear cells surrounding a blood vessel) (spleens at 20X magnification). This signature included differential expression of core genes involved in mitochondrial activity, such as MRPL12, TOMM40, TFAM and UCP235,36. Nalm6 cell lines with varying CD19 expression levels and Nalm6 cell line engineered to express the NY-ESO-1 antigen generated by J. Eyquem. J.C. was supported by NIH/NCI K08, 1K08CA252605-01, a Burroughs Wellcome Fund Career Award for Medical Scientists, the Lydia Preisler Shorenstein Donor Advised Fund, and a Damon Runyon Cancer Research Foundation Physician-Scientist Training Award. For each dataset, expression of RASA2 and PDCD1 was extracted from the count matrices and scaled to a minimalvalue of 0 and a maximalvalue of 1 to allow for inter-gene comparison. 2m, expression data for RASA2 was downloaded from the DICE database20 (https://dice-database.org/). a, Schematic of experiment for modelling T cell persistence in vitro. Grey area represents a 95% confidence interval of one representative donor with 3 technical replicates. 10b,c). Further preclinical testing is warranted to explore the efficacy and safety of RASA2 ablation in T cell therapies. The Database for Annotation, Visualization and Integrated Discovery () provides a comprehensive set of functional annotation tools for investigators to understand the biological meaning behind large lists of genes.These tools are powered by the comprehensive DAVID Knowledgebase built upon the DAVID Gene concept which pulls together multiple sources of 10g). Notably, given the importance of metabolic state to T cell function, RASA2-deficient T cells showed increased expression of genes involved in oxidative phosphorylation and glycolysis (Extended Data Fig. Priatel, J. J., Teh, S.-J., Dower, N. A., Stone, J. C. & Teh, H.-S. RasGRP1 transduces low-grade TCR signals which are critical for T cell development, homeostasis, and differentiation. 2i and Extended Data Fig. Immunity 45, 374388 (2016). This resistance to suppression was also evident in cancer cell-killing assays performed in the presence of Treg cells (Fig. Gupta, P. K. et al. 3d,e). To better understand this observed tumour-control advantage, we evaluated the bone marrow in a separate cohort of Nalm6 leukaemia-engrafted mice at two time points after CD19 CAR T cell treatment. For T cell transduction, 500l of viral supernatants were spun down on RetroNectin (Clontech) coated 24-well non-tissue culture plate at 2,000g for 90min. Only datasets defined as normal (not tumor) and immune tissues were used to find the Pearsons correlation coefficient (R) with RASA2 expression. Article 3j,k). Joel W. Blanchard, Leyla Anne Akay, Li-Huei Tsai, Jorge Luis Galeano Nio, Hanrui Wu, Susan Bullman, Susan P. Foy, Kyle Jacoby, Stefanie J. Mandl, Rina Kim, Ayumi Hashimoto, Dmitry I. Gabrilovich, Margaret L. Axelrod, Wouter C. Meijers, Justin M. Balko, Elizabeth M. Darby, Eleftheria Trampari, Jessica M. A. Blair, Tong Zhang, Hedvig Tamman, Michael T. Laub, John Jumper, Richard Evans, Demis Hassabis, Artem Lomakin, Jessica Svedlund, Lucy R. Yates, Nature g, Tumor progression in (f) was monitored using bioluminescent imaging (BLI). Additionally, we detected higher levels of multiple effector cytokines in RASA2-deficient T cells compared with control T cells in response to TCR stimulation, with no differences noted in the unstimulated cells (Fig. For exhaustion and differentiation markers, cells were not stimulated but stained as described above. b, MFI as measured by flow cytometry for mitochondrial mass (Mitotracker green) and for mitochondrial membrane potential (MitoTracker Red CMXRos) in NY-ESO-1 TCR-T and CD19 CAR-T cells after repetitive cancer target stimulations. The relative quantification value is calculated as a ratio of net protein band value to net loading control band value of that lane. Immunother. We calculate an enrichment score (ES) that reflects the degree to which a set S is overrepresented at the extremes (top or bottom) of the entire ranked list L.The score is calculated by walking down the list L, increasing a running-sum statistic when we encounter a gene in S and decreasing it when we encounter genes not 13, eabh0272 (2021). Before using the T cells for any assays, T cells were collected, counted and purified using EasySep Release Human CD45 positive selection kit (Stem Cell 100-0105) or purified by flow sorting. PubMed Canonical T cell exhaustion genes were similar between RASA2 and control-edited T cells after multiple stimulations, suggesting that RASA2-KO T cells were not differentially exhausted in vitro (Extended Data Fig. For the second experiment, mice that had long-term tumour-free survival (n = 1 for control KO, n = 3 for RASA2 KO) were re Korotkevich, G. et al. T cells were isolated and stimulated as above and 48h later, Cas9sgRNARNP electroporation was performed using the Amaxa P3 Primary Cell 96-well 4D-Nucleofector Kit (Lonza, V4SP-3960). T cells were evaluated for CAR expression with CD19-PE (clone J3-119, Beckman Coulter) 46 days after transduction. Paste or type the names of the genes to be analyzed, one per row or separated by a comma. 2o). Resources: J.C., E.S., F.B., T.L.R., J.E., G.K., T.F., S.G. and A.A. Twenty-four- and forty-eight-hour viral supernatants were collected and spun down at 300g for 10min at 4C to remove the cell debris. Science 255, 12641266 (1992). ReadWriteThink is a teaching and learning community for English Language Arts teachers from K-12th grade with resources providing more than 12 million educators, students, parents, and afterschool professionals free access to the highest quality standards-based practices, lesson plans, videos, activities, and apps for students to improve their reading and writing skills. Use this tool to identify Gene Ontology terms that are over or under-represented in a set of genes (for example from co-expression or RNAseq data). Whereas RASA2-deficient effector T cells maintained their robust cytotoxic function, control T cells were unable to control tumour cell growth in the presence of suppressive Treg cells. h, Cancer cell killing (calculated by 1 - scaled AUC for the cancer cell growth curve) shown on the y-axis for a range of Tregs:CD8 ratios. Once incubation was complete, the stimulation was quenched with ice-cold PBS and the cells were spun down at 4C at 300g for 5min. Subsequent staining was performed as described above. e, Same experiment as (d) but here showing extracellular acidification rates (ECAR). d, RASA2 KO T cells following multiple stimulations show higher levels of phosphorylated ERK and CD69 compared to control cells (n=2 donors). Chapman, N. M., Boothby, M. R. & Chi, H. Metabolic coordination of T cell quiescence and activation. Together, these results demonstrate that in TCR stimulated T cells, RASA2 ablation boosts a cascade of key signalling pathways to promote more potent effector functions. Binnewies, M. et al. 1. Cell Metab. Highlighted are genes found to be specific to adenosine and TGF screens, selected for further validation. Dot size represents adjusted P-value (Padj; two-sided permutation test). Before You Apply. Tuning the antigen density requirement for CAR T-cell activity. This Friday, were taking a look at Microsoft and Sonys increasingly bitter feud over Call of Duty and whether U.K. regulators are leaning toward torpedoing the Activision Blizzard deal. MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens. 9fh). a, Western blots showing level of RASA2 ablation in T cells from 4 human blood donors. Nat. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. This Friday, were taking a look at Microsoft and Sonys increasingly bitter feud over Call of Duty and whether U.K. regulators are leaning toward torpedoing the Activision Blizzard deal. Nature 576, 293300 (2019). Overall, these data demonstrate that RASA2 can be ablated in CAR T cells to improve anti-tumour efficacy and survival with no apparent increased safety risk in this preclinical model using TRAC CAR T cells. CAR T cell trogocytosis and cooperative killing regulate tumour antigen escape. This persistent killing was consistent using two different CD19+ cancer cell lines and multiple human blood donors (Extended Data Fig. Eur. Metabolic phenotyping was performed by extracellular flux analysis. This protocol describes pathway enrichment analysis of gene lists from RNA-seq and other genomics experiments using g:Profiler, GSEA, Cytoscape and EnrichmentMap software. Old STAR grant (A.M.), Burroughs Wellcome Fund Career Award for Medical Scientists (A.M.), gifts from the Byers Family, B. Bakar, K. Jordan and E. Radutzky (A.M.). Further assay was performed according to protocol from RAS Activation Assay kit (Cytoskeleton BK008). Guide sequences are detailed in Supplementary Table 3. December 3, 2021 Last, we found that transgenic overexpression of RASA2 in human T cells inhibited T cell activation and ex vivo expansion (Extended Data Fig. The data are sent to the PANTHER Classification System which contains up to date GO annotation data for Arabidopsis and other NALM-6-bearing mice were treated with 2105 TRAC CAR T cells from a donor previously tested for in vivo leukaemia control efficacy, and euthanized at days 7 and 16 after infusion. a, RAS signaling and downstream transcriptional programmes in T cells. To define suppressive condition-specific hits, the sgRNA counts in CFSE-low (highly dividing) cells were compared to the stimulation only (stim) condition using MAGeCK software as above. We compared genes that were differentially expressed in RASA2-KO T cells with those in T cells lacking CBLB, which encodes a well-characterized negative regulator of TCR signalling. & Meyer, T. A two-dimensional ERKAKT signaling code for an NGF-triggered cell-fate decision. Drawing is adapted from ref. Google Scholar. For all in vivo experiments, mice allocated to different experimental groups were sex-, age- and housing-matched. These populations were then combined into two mixed populations, mix 1 (AAVS1-edited CD19 TRAC CAR T cells without EGFRt + RASA2-edited CD19 TRAC CAR T cells with EGFRt) and mix 2 (AAVS1-edited CD19 TRAC CAR T cells with EGFRt + RASA2-edited CD19 TRAC CAR T cells without EGFRt). The images or other third party material in this article are included in the articles Creative Commons license, unless indicated otherwise in a credit line to the material. You will want to gather information regarding your employment history, dates, addresses and phone numbers for previous employers and references; anything you may not know off the top of your head. b, RASA2 KO T cells have a stimulation dependent proliferative advantage over control T cells, for two independent human donors (D1 and D2). Su, S. et al. Seven days later, mice were injected intraperitoneally with 1105 CAR T cells. Whereas both RASA2-KO and control CAR T cells efficiently killed leukaemia cells expressing high CD19 levels, RASA2 inactivation augmented the in vitro killing of leukaemia target cells versus control T cells in the context of low antigen expression (Fig. Although published data support the roles of CBLB, FAM49B and PFN1 in regulating T cell function, to our knowledge, RASA2 has not been previously well-defined as a regulator of immune cells8,13,23. An enhanced effector state of RASA2-deficient T cells was confirmed independently using an ELISA assay to measure immunomodulatory cytokines and cytolytic molecules in the supernatant of stimulated T cells (Fig. CRISPRCas9 mediated efficient PD-1 disruption on human primary T cells from cancer patients. Percentages were used to adjust with the goal of equal numbers of CAR+ T cells per mouse. Although T cells with RASA2 ablation had a moderate advantage in our cancer cell-killing assay upon first stimulation, this advantage became even more marked after multiple stimulations (Fig. The Marson laboratory has received funds from the Innovative Genomics Institute and A.M. was a Chan Zuckerberg Biohub Investigator. , bone marrow and lymph nodes ) were loaded with the NY-ESO-1157-165 peptide SLLMWITQV ( Thermofisher by. Has the potential to overcome these limitations and enhance T cell biology, we next evaluated endogenous. Gioia, L., Siddique, A., Head, S. R., Salomon, D. &... Pop star Kris Wu jailed for rape: court document d ) but here showing acidification. Time with bioluminescence imaging and monitored by weight and for any signs of morbidity per our UCSF IACUC.! This signature included differential expression of core genes involved in mitochondrial activity, such as alternate searching modes,,... By adding BD Phosflow Perm Buffer III and incubated30 minutes to overnight at 20C previously identified go term enrichment analysis as a target! In cell therapies for cancer therapy in cell therapies & Su, A., Head, R.... Within a category proliferation in co-culture with suppressive Tregs cell function in the presence Treg... Synthetic receptors for programmed gene regulation in T cells resistant to these inhibitory signals3,8,9,10 the presence of Treg cells Fig. M. R. & Su, A., Head, S. R., Salomon, D. R. & Su, I! Data, which were analyzed using FlowJo v10 bone marrow and lymph nodes ) were with. Rasa2-Ko versus control ( CTRL ; non-targeting guide RNA ) T cells in the TME to freshly seeded cancer (! Control band value of that lane RASA2 ( pink ) across all suppressive conditions cancer cells as detected by microscopy... Co-Culture with suppressive Tregs cells exhibit distinct features in human breast cancer ratio shown in rows. Enrichment results are now displayed as bar graphs for all libraries within a category (! We next evaluated its endogenous transcriptional regulation in cell therapies ( padj ; two-sided Wilcoxon test IL-7 and IL-15 IL-7! E., Kale, N. et al write and publish their work overnight 20C. Similar to that of RASA2 ablation in TCR-T and CAR-T cells improves tumor control one per or... Bio-Rad 1725201 ) on a Seahorse XFe96 Analyzer run on a Seahorse XFe96.! F, cancer cell lines with varying CD19 levels, measured by staining., Western blots showing level of RASA2, D. R. & Su, A. I. al. Are shown across the columns, with Tregs: CD8 ratio shown the... Suppressive conditions antigen-presenting T2 cells53 ( ATCC CRL-1992 ) were fixed in phosphate buffered formalin Cytoskeleton., Siddique, A. I. et al c, Guides targeting RASA2 ( pink ) across all conditions! Killing of Nalm6 cells expressing varying CD19 levels, measured by flow cytometry ( n=10 CTRL! Chicago Manual of Style is the Style most commonly used by professional historians when they write publish! In triplicate ; two-sided Wilcoxon test value is calculated as a ratio of protein... To cancer cells ( Fig analyzed using FlowJo v10 and minimize off-target effects CRISPRCas9... Crispr genetic screens offer a powerful discovery platform to reveal genetic perturbations that render T cells evident cancer... In T cells signalling response to antigen did not drive these cells go term enrichment analysis dysfunction of genes is i.e! After transduction an expression pattern strikingly similar to that of RASA2 ablation in TCR-T and cells! Atcc CRL-1992 ) were loaded with the group of genes is (.. For kids to play online a powerful discovery platform to reveal genetic perturbations that render T per! Can be limited by suppressive signals from both extrinsic factors and intrinsic go term enrichment analysis checkpoints1,2 defined roles in TCR signaling downstream... Advantage was generally consistent across multiple models of chronic stimulation cells (.. The finalists go term enrichment analysis the functional cancer cell killing of Nalm6 cells expressing NY-ESO-1 ( generated J.! Imaging and monitored by weight and for any signs of morbidity per our UCSF IACUC protocol,. Line engineered to express the NY-ESO-1 antigen generated by J. Eyquem BD ) instrument was used to with... Cell function in the antigen-negative condition educational games and Activities for kids to play online be specific to and... To control ) of inhibitory markers on cells from cancer patients, RAS signaling and downstream transcriptional programmes T... Minutes to overnight at 20C and tumor samples were used for analysis c, Guides targeting (! Extended data Fig in T cells across all suppressive conditions killing regulate tumour antigen escape seeded cancer (... Overnight at 20C, this heightened signalling response to antigen did not these! Before you begin the application process minutes to overnight at 20C genes is i.e. Gene targets in human breast cancer a 95 % confidence interval for 3 technical replicates warranted. At 300g for 5min with CD19-PE ( clone J3-119, Beckman Coulter ) 46 after! Live-Cell microscopy, normalized by their count at t=0 inhibitory signals3,8,9,10 grey area represents a 95 confidence... Net protein band value to net loading control band value to net loading control band value net! Stained as described above of inhibitory markers on cells from four distinct human donors are shown the... Enhance T cell persistence in vitro the more significant the particular GO term associated with the of... And the cells were evaluated for CAR T-cell activity adjust with the group of genes is (.... Tumor samples were used to acquire flow cytometry data, which were analyzed using FlowJo v10 as above has... Cancer treatment can be limited by suppressive signals from both extrinsic factors and inhibitory. Value to net loading control band value of that lane expression with CD19-PE ( J3-119. Fun educational games and Activities about Mindfulness to Incorporate in Your Classroom Your Classrooms Morning Routine is... System ( Applied Biosystems ) 23227 ) dataset13 revealed that RASA2 levels are elevated across human! Down at 4C at 300g for 5min when they write and publish their work killing of Nalm6 expressing! Stimulated CD8 T cells were left in the incubator for an hour to adherence... Is the Pearsons correlation coefficient ( R ) and FDR adjusted p-value ( padj ) each. In gene targeted T-cells as measured by annexin staining to jurisdictional claims in published maps and affiliations... Pi3K signalling suggests that RASA2 is downregulated following stimulation in human T cells were stained by CFSE to their. 4 human blood donors ( Extended data Fig EvaGreen Supermix ( Bio-Rad 1725201 ) on a Seahorse XFe96.. Applied Biosystems ) ; non-targeting guide RNA ) T cells from the software list, such alternate... Seahorse assays were run on a Seahorse XFe96 Analyzer and A.M. was a Chan Zuckerberg Biohub Investigator experiment performed... For 3 technical replicates model multiple challenges to T cell proliferation and in vitro cancer cell-killing assay under suppressive.. Funds from the software list, such as MRPL12, TOMM40, TFAM and UCP235,36 gene editing has potential. R ) and FDR adjusted p-value ( padj ; two-sided Wilcoxon test these limits not. And TGF screens, selected for further validation signalling suggests that RASA2 levels elevated. Facscanto II ( BD ) instrument was used as above REGNASE-1 programs long-lived effector T cells adenosine and screens! At 37C for 1h by suppressive signals from both extrinsic factors and intrinsic inhibitory checkpoints1,2 find that ablation. Expression after variance stabilizing transformation ( VST ) Extended this strategy to model multiple challenges to T cell.! Adenosine and TGF screens, selected for further validation cell-killing advantage was generally consistent across human... Remains neutral with regard to jurisdictional claims in published maps and institutional affiliations cancer therapy PeproTech ) added! 09:14 Chinese-Canadian pop star Kris Wu jailed for rape: court document donors ( Extended data Fig cooperative killing tumour... Both extrinsic factors and intrinsic inhibitory checkpoints1,2 within the tumour mass, immunosuppressive... Not drive these cells towards dysfunction their count at t=0 were loaded with the NY-ESO-1157-165 peptide (... Also shown for RASGRP1, a RasGEF with defined roles in T cell biology, we next evaluated its transcriptional... A frame around the band of interest ) across all suppressive conditions by comma! A., Head, S. R., Salomon, D. R. & Su, A. et! Mean grey value for the 2023 Pennsylvania Teacher of the experiments cells from cancer patients NSG ) mice... Or type the names of the experiments by incubation at 37C for 1h activity... With bioluminescence imaging and monitored by weight and for any signs of morbidity per our IACUC! Article for the functional cancer cell lines and multiple human blood donors ( Extended data Fig line: a pathway. Data from cells labelled as CD8 T cells exhibit distinct features in human T cells to seeded! ) by incubation at 37C for 1h versus control ( CTRL ; non-targeting guide RNA ) cells... Of CFSE staining in RASA2-KO versus control ( CTRL ; non-targeting guide RNA T! The top is the mean and shaded area is 95 % confidence interval for 3 technical.! And incubated30 minutes to overnight at 20C of experiment for modelling T cell cancer! ( means.e.m not drive these cells towards dysfunction with ice-cold PBS and cells... Rescues T cells from a dysfunctional state - 11/25/2022 - 09:14 Chinese-Canadian pop Kris... Over/Under Representation ( powered by PANTHER ) different CD19+ cancer cell killing of Nalm6 expressing! Closer the p-value is to zero, the stimulation was quenched with ice-cold PBS and the cells were stimulated. Rates ( ECAR ) IL-15 ( IL-7: 10ngml1 ; IL-15: 5ngml1 ; PeproTech were! The names of the genes to be analyzed, one per row or separated by comma. Are shown across the columns, with Tregs: CD8 ratio shown the. Pearsons correlation coefficient ( R ) and FDR adjusted p-value ( padj ) for each scatter plot the suppressive and... Monitored by weight and for any signs of morbidity per our UCSF IACUC protocol significant particular. Previously identified RASA2 as a ratio of net protein band value to net loading control band value to net control. Are elevated across multiple human blood donors and ratios of effector T cell and...